How do caspases activate apoptosis?
The apoptosis death signal is activated via a series of protease caspases (initiator caspases-2, 8, 9, and 10, and effector caspases-3, 6, and 7) which require activation by proteolysis [43,44].
What is the function of initiator caspase?
Initiator caspases contain long prodomains (>90 amino acids) that allow them to interact with specific signaling complexes (see Section 2.28.2.2) and initiate the execution phase of apoptosis in response to specific death stimuli.
What is the function of caspase in cell cycle?
Caspase. This is a form of programmed cell death, occurring widely during development, and throughout life to maintain cell homeostasis. Activation of Caspases ensures that the cellular components are degraded in a controlled manner, carrying out cell death with minimal effect on surrounding tissues.
What are the mediators of caspase 1 activation?
Caspase-1 activation is mediated by a repertoire of proteins, allowing detection of a range of pathogenic ligands. Some mediators of Caspase-1 activation are: NOD-like Leucine Rich Repeats (NLRs), AIM2 -Like Receptors (ALRs), Pyrin and IFI16.
Which caspase acts as initiator of apoptosis?
CED-3, the Death Caspase in C. elegans, CED-3 is the only one that has been shown to be required for apoptosis. It is a CARD-containing caspase that acts both as initiator and effector caspase.
Is caspase-3 an initiator?
Caspase-9 in mammals and Dronc in Drosophila are initiator caspases, whereas caspases-3 and -7 in mammals and DrICE in Drosophila belong to effector caspases. CED-3 in C. elegans is both the initiator and the effector caspase.
Is caspase-7 an initiator caspase?
Apoptopic caspases are subcategorised as: Initiator Caspases (Caspase 2, Caspase 8, Caspase 9, Caspase 10) Executioner Caspases (Caspase 3, Caspase 6 and Caspase 7)
Is caspase-9 an initiator caspase?
In most known forms of intrinsic apoptosis, caspase-9 and caspase-3/7 are the initiator and the downstream effector caspases, respectively.
What is the role of caspase-3 in apoptosis?
Caspases are crucial mediators of programmed cell death (apoptosis). Among them, caspase-3 is a frequently activated death protease, catalyzing the specific cleavage of many key cellular proteins. However, the specific requirements of this (or any other) caspase in apoptosis have remained largely unknown until now.
What are caspase-3 and 9?
Caspase 3 appears to amplify caspase 8 and caspase 9 initiation signals into full-fledged commitment to disassembly. Caspase 8 and caspase 9 activate caspase 3 by proteolytic cleavage and caspase 3 then cleaves vital cellular proteins or other caspases.
What is the function of caspase-3 and 7?
Caspase 3 controls DNA fragmentation and morphologic changes of apoptosis, whereas caspase 7 plays little role in these processes. In contrast, caspase 7 appears to be more important to the loss of cellular viability, although the combined role of both caspases is crucial in this area.
What is the role of caspase 8 in apoptosis?
Caspase-8 is a critical molecule as its absence leads to death of mice in utero. Upon activation, its main function is to promote apoptosis and, in thymus, apoptosis of negative selection is critical to eliminate autoaggressive T-cell clones that, if not eliminated, could contribute to develop autoimmune diseases.
Where is caspase-3 activated?
apoptotic cellActivation. Caspase-3 is activated in the apoptotic cell both by extrinsic (death ligand) and intrinsic (mitochondrial) pathways. The zymogen feature of caspase-3 is necessary because if unregulated, caspase activity would kill cells indiscriminately.
Is caspase-3 a marker of apoptosis?
This caspase is responsible for the majority of proteolysis during apoptosis, and detection of cleaved caspase-3 is therefore considered a reliable marker for cells that are dying, or have died by apoptosis. This protocol outlines the quantification of apoptosis by flow cytometric detection of cleaved caspase-3.
What is the function of caspase-9?
Caspase-9 is essential to eliminate cells by executing apoptotic death early in development stage as it is indispensable to inhibit proliferative diseases through the continuous removal of irreparable cells in the lifecycle.
How is caspase-3 activated?
Caspase-3 is a cysteine–aspartic acid protease that cleaves cellular targets and executes cell death. Our current understanding is caspase-3 is activated by the cleavage of the interdomain linker and then subsequent cleavage of the N-terminal prodomain.
Why is it important to use specific activators and inhibitors of caspase activity?
In these situations, the use of specific activators and/ or inhibitors of caspase activity is essential to ensuring determination of the correct activity. Another important consideration when looking at caspase activation is to ensure that the specific caspase is activated in the sample you have chosen.
Is the signal proportional to the amount of caspase activity present in the sample?
The resulting signal is proportional to the amount of caspase activity present in the sample. However, many of the cleavage sites are similar and can be cleaved by other caspases. For example, caspase 3 and 7 have very similar cleavage sites.
Which caspase is activated upon apoptosis?
In the lepidopteran Spodoptera frugiperda, an effector caspase called Sf-caspase-1 is activated upon apoptotic signaling ( Seshagiri and Miller, 1997; LaCount et al., 2000 ), and silencing Sf-caspase-1 reduces apoptosis ( Lin et al., 2007 ). In A. aegypti, homologs of Dronc and Ark are required for apoptosis, while silencing the expression of either of two effector caspases related to Drice (CASPS7 or CASPS8) also reduces apoptosis ( Liu and Clem, 2011 ).
Which caspases are involved in apoptosis?
Caspases Involved in Apoptosis. The two caspases that are most important in apoptosis in D. melanogaster are the initiator caspase Dronc and the effector caspase Drice (Fig. 4 ). Like other initiator caspases, activation of Dronc requires binding to an adaptor protein.
What is the pathway that activates caspase 2?
An additional pathway critical to activation of the initiator caspases, such as caspase 2, is that of DNA damage . DNA damage promotes p53-dependent transcriptional upregulation of p53-induced protein with a death domain (PIDD).59 In response to injurious stimuli, PIDD forms the PIDDosome death complex, a large (molecular weight >670 kDa) macromolecular signaling platform that recruits and activates procaspase 2 in response to DNA damage and stress ( Fig. 5-7 ). 60 The PIDDosome contains PIDD, the adapter protein RIP-associated Ich-1/Ced-3-homologue protein with a death domain (RAIDD), and procaspase 2. PIDD interacts via its death domain to bind RAIDD and acts via its caspase-recruitment domain (CARD) to recruit procaspase 2. 61 Although the details of caspase 2 activation are not well delineated, the PIDDosome is thought to promote autocleavage of procaspase 2 to generate caspase 2. 62 Upon activation, caspase 2 acts upstream of mitochondria to promote proteolytic cleavage of the BH3-only protein Bid, translocation of Bax to the mitochondria, opening of the mitochondrial permeability transition pore, and release of cytochrome c. 52 It is the only caspase that when added to purified mitochondria can directly induce cytochrome c release. A 2008 article by the Chan group 63 demonstrates that brief global ischemia promotes expression of a short cleaved fragment of PIDD (PIDD-CC), formation of the PIDDosome, PIDD-dependent activation of procaspase 2, cleavage of Bid, and neuronal death in the hippocampal CA1. These findings implicate the PIDDosome in neuronal death induced by global ischemia.
How does PIDD control cell survival?
Recent evidence indicates that PIDD can act as a molecular switch, controlling the balance between cell survival and death in response to DNA damage. 66,67 Depending on the cellular conditions, PIDD can form a distinct prosurvival complex by assembly with the death domain–containing kinase Rip1 and the sumoylated form of NF-κB essential modulator (NEMO). 66 This complex, which resides in the nucleus, phosphorylates the inhibitor of NF-κB, IκB, and releases it from NF-κB. On activation, NF-κB enters the nucleus, where it promotes transcription of mainly prosurvival genes. These findings, while greatly increasing our understanding of how PIDD controls cell survival, also raise important questions. What controls formation of the death signaling PIDDosome versus the prosurvival PIDDosome? It is known that PIDD undergoes proteolytic cleavage to a longer C-terminal cleavage product (PIDD-C), which favors formation of the prosurvival complex and a shorter cleavage product (PIDD-CC), which in turn favors formation of the death complex; the cellular factors that shift the balance between the two are, however, as yet unclear. In addition to DNA damage, several studies implicate endoplasmic reticulum stress and the accumulation of misfolded proteins in activation of caspase 2. 68
How does PIDD affect cell fate?
Recent studies show that PIDD can act as a sensor to determine cell fate, controlling the balance between cell survival and death in response to genotoxic stress. 64,65 PIDD can form a distinct prosurvival complex by binding with kinase RIP1 and the sumoylated form of NF-κB essential modulator (NEMO) to activate cell survival pathway. 64 This complex phosphorylates the inhibitor of NF-κB, IκB, and releases it from NF-κB. Upon activation, NF-κB enters the nucleus, where it promotes transcription of mainly prosurvival genes. In addition, PIDD recruits RAIDD to form PIDDosome and then trigger cell proapoptosis via caspase 2. 66
What is the role of Diap1 in apoptosis?
Diap1 directly binds and inhibits effector caspases, Drice and Dcp-1 [30,75–79]. As such, loss of Diap1 results in spontaneous activation of caspases leading to rapid apoptosis [76,77].
How are caspases activated?
Long prodomain-containing initiator caspases exist as inactive monomers and are activated by proximity-induced dimerization which can sometimes be facilitated by adaptor proteins.
How are apoptotic caspases activated?
Apoptotic caspases are activated upon the receipt of either an extrinsic or an intrinsic death signal. The extrinsic pathway (green arrows) is initiated by ligand binding to cell surface death receptors (TNF RI, Fas/CD95, DR3, TRAIL R1/DR4, TRAIL R2/DR5) followed by receptor oligomerization and cleavage of Pro-caspase-8 and -10.
What are the roles of initiator caspases in signal transduction?
Once activated, initiator caspases cleave downstream effector caspases that promote the ordered disassembly of the cell by targeting a number of critical cellular proteins including structural proteins, DNA repair proteins, and proteins involved in signal transduction pathways.
What proteins are activated in the mitochondrial membrane?
Bax and BAK, or processed forms of these proteins, can then insert into the mitochondrial membrane, compromising its integrity. Initiator caspases are activated in three distinct protein complexes, the death-inducing signaling complex (DISC; Caspase-8 and -10), the apoptosome (Caspase-9), and the PIDDosome (Caspase-2).
What are the three functional groups of caspases?
Mammalian caspases can be subdivided into three functional groups, apoptotic initiator caspases (Caspase-2, -8, -9, -10), apoptotic effector caspases (Caspase-3, -6, -7) , and caspases involved in inflammatory cytokine processing ...
What is the role of p53 in DNA damage?
Following DNA damage, p53 induces the expression of p53-induced protein with a death domain (PIDD), which associa tes with the CRADD/RAIDD adaptor protein and Pro-caspase-2 to form the PIDDosome.
Where does autocatalytic cleavage occur?
Autocatalytic cleavage of the initiator pro-caspases occurs at aspartic acid residues located after the pro-domain, and in between the large and the small subunits. Upon cleavage, mature caspases form a proteolytically active heterotetramer consisting of two small and two large subunits.
What is the gene that encodes a protein required for cell death?
In the nematode Caenorhabditis elegans, the gene ced-3 encodes a protein required for developmental cell death. Since the recognition that CED-3 has sequence identity with the mammalian cysteine protease interleukin-1 beta-converting ...
Is caspase 1 a heterotetramer?
The crystal structures of both caspase-1 and caspase-3 show that the active enzyme is a heterotetramer, containing two small and two large subunits. Activation of caspases during apoptosis results in the cleavage of critical cellular substrates, including poly (ADP-ribose) polymerase and lamins, so precipitating the dramatic morphological changes ...
Which caspases are activated during apoptosis?
Initiation of apoptosis first activates initiator caspases, such as caspase 8, the role of which is to cleave other pro-caspases into active 'executioner' caspases.
What is the final step of apoptosis?
Both of these end with a final common effector pathway, known as the execution phase.
What happens if apoptosis fails?
If apoptosis fails in these sites, or in another site where it is essential to development, a variety of conditions can develop including syndactyly ( webbed fingers), cleft palate or spina bifida.
What determines whether a cell will survive or undergo apoptosis in response to internal stimuli?
The balance between the relative concentrations of these groups of molecules establishes a ‘molecular switch ’ which determines whether a cell will survive or undergo apoptosis in response to internal stimuli.
What is the role of apoptosis in cell death?
Apoptosis has a role in cell death leading to removal of vestigial remnants from earlier in development, such as the pronephros. caption] Regulation of Apoptosis. There are a variety of factors responsible for regulating apoptosis, which can be intracellular or extracellular.
What is the role of apoptosis in embryonic development?
Roles of Apoptosis. Aside from providing a regulated form of cell death, for example for cells with irreparable DNA damage, apoptosis plays a major role in embryonic development. Removal of cells via apoptosis is responsible for developing tissue's form and shape, including:
What is apoptosis in biology?
bookmarks Recommended reading. Apoptosis is a physiological process in which cell death is brought about through a heavily regulated sequence of events. It leads to the programmed removal of targeted cells, without harming nearby cells. Defects of this process play an important role in a variety of diseases.
What is the role of caspase 8 in apoptosis?
Note that in addition to apoptosis, caspase-8 is also required for the inhibition of another form of programmed cell death called necroptosis. Caspase-14 plays a role in epithelial cell keratinocyte differentiation and can form an epidermal barrier that protects against dehydration and UVB radiation.
What is the activation of caspase 1?
These proteins allow caspase-1 activation by forming a multiprotein activating complex called Inflammasomes. For example, a NOD Like Leucine Rich Repeat NLRP3 will sense an efflux of potassium ions from the cell. This cellular ion imbalance leads to oligomerisation of NLRP3 molecules to form a multiprotein complex called the NLRP3 Inflammasome. The pro-caspase-1 is brought into close proximity with other pro-caspase molecule in order to dimerise and undergo auto-proteolytic cleavage.
What is the apoptosome pathway?
This leads to the formation of a Caspase activating multiprotein complex called the Apoptosome. Once activated, initiator caspases such as Caspase 9 will cleave and activate other executioner caspases. This leads to degradation of cellular components for apoptosis.
What is the pro-domain of the intrinsic initiator caspases and the inflammatory caspases?
The pro-domain of the intrinsic initiator caspases and the inflammatory caspases contains a single death fold known as caspase recruitment domain (CARD), while the pro-domain of the extrinsic initiator caspases contains two death folds known as death effector domains (DED).
How does the caspase cascade work?
Extrinsic apoptopic pathway: The caspase cascade is also activated by extracellular ligands, via cell surface Death Receptors. This is done by the formation of a multiprotein Death Inducing Signalling Complex (DISC) that recruits and activates a pro-caspase. For example, the Fas Ligand binds the FasR receptor at the receptor's extracellular surface; this activates the death domains at the cytoplasmic tail of the receptor. The adaptor protein FADD will recruit (by a Death domain-Death domain interaction) pro-Caspase 8 via the DED domain. This FasR, FADD and pro-Caspase 8 form the Death Inducing Signalling Complex (DISC) where Caspase-8 is activated. This could lead to either downstream activation of the intrinsic pathway by inducing mitochondrial stress, or direct activation of Executioner Caspases (Caspase 3, Caspase 6 and Caspase 7) to degrade cellular components as shown in the adjacent diagram.
What are the roles of caspases in cell development?
There are other identified roles of caspases such as cell proliferation, tumour suppression, cell differentiation, neural development and axon guidance and ageing. Caspase deficiency has been identified as a cause of tumour development.
How are caspases activated?
The activation of initiator caspases and inflammatory caspases is initiated by dimerisation, which is facilitated by binding to adaptor proteins via protein–protein interaction motifs that are collectively referred to as death folds. The death folds are located in a structural domain of the caspases known as the pro-domain, which is larger in those caspases that contain death folds than in those that do not. The pro-domain of the intrinsic initiator caspases and the inflammatory caspases contains a single death fold known as caspase recruitment domain (CARD), while the pro-domain of the extrinsic initiator caspases contains two death folds known as death effector domains (DED).
What is the role of caspase 8 in apoptosis?
Caspase-8 is the initiator caspase of extrinsic apoptosis 1, 2 and inhibits necroptosis mediated by RIPK3 and MLKL. Accordingly, caspase-8 deficiency in mice causes embryonic lethality 3, which can be rescued by deletion of either Ripk3 or Mlkl 4, 5, 6. Here we show that the expression of enzymatically inactive CASP8 (C362S) causes embryonic lethality in mice by inducing necroptosis and pyroptosis. Similar to Casp8−/− mice 3, 7, Casp8C362S/C362S mouse embryos died after endothelial cell necroptosis leading to cardiovascular defects. MLKL deficiency rescued the cardiovascular phenotype but unexpectedly caused perinatal lethality in Casp8C362S/C362S mice, indicating that CASP8 (C362S) causes necroptosis-independent death at later stages of embryonic development. Specific loss of the catalytic activity of caspase-8 in intestinal epithelial cells induced intestinal inflammation similar to intestinal epithelial cell-specific Casp8 knockout mice 8. Inhibition of necroptosis by additional deletion of Mlkl severely aggravated intestinal inflammation and caused premature lethality in Mlkl knockout mice with specific loss of caspase-8 catalytic activity in intestinal epithelial cells. Expression of CASP8 (C362S) triggered the formation of ASC specks, activation of caspase-1 and secretion of IL-1β. Both embryonic lethality and premature death were completely rescued in Casp8C362S/C362SMlkl−/−Asc−/− or Casp8C362S/C362SMlkl−/−Casp1−/− mice, indicating that the activation of the inflammasome promotes CASP8 (C362S)-mediated tissue pathology when necroptosis is blocked. Therefore, caspase-8 represents the molecular switch that controls apoptosis, necroptosis and pyroptosis, and prevents tissue damage during embryonic development and adulthood.
What cells express CASP8?
To further characterize the cells that express CASP8 (C362S), we isolated endothelial cells from Casp8C362S/fl and Casp8WT/fl mice and induced Casp8 gene deletion in vitro using a cell-permeable active Cre protein (HTNCre) 18 (Extended Data Fig. 3a ). Endothelial cells that expressed CASP8 (C362S) were unable to activate caspase-3 in response to TNF, but were sensitized to TNF-induced necroptosis, as the cytotoxic effect of TNF was associated with MLKL phosphorylation and was abolished by co-treatment with necrostatin-1 (Nec-1) (Extended Data Fig. 3b, c ). Loss of RIPK3 or MLKL was previously shown to inhibit necroptosis and to prevent the embryonic lethality caused by caspase-8 knockout 4, 5, 6. Similar to Casp8−/−Ripk3−/− mice, Casp8C362S/C362SRipk3−/− mice survived weaning but showed markedly stunted growth and suffered from anaemia with distinct haematological abnormalities that led to splenomegaly (Fig. 2a, b and Extended Data Fig. 3d–g ). MLKL deficiency 19 did not rescue the lethality caused by the CASP8 (C362S) mutation, leading to perinatal death of Casp8C362S/C362SMlkl−/− mice (Fig. 2c and Extended Data Fig. 3h ). Although Casp8C362S/C362SMlkl−/− embryos were present at E13.5 in expected numbers and without any gross phenotypic alterations (Extended Data Fig. 4a ), deletion of MLKL did not lead to Casp8C362S/C362S animals reaching weaning age. Together, necroptosis deficiency did not fully lead to Casp8C362S/C362S animals reaching adulthood, which suggests that the loss of the enzymatic activity of caspase-8 compromises perinatal development by additional, necroptosis-independent functions.
Which kinase is involved in autoimmune disease?
Alvarez-Diaz, S. et al. The pseudokinase MLKL and the kinase RIPK3 have distinct roles in autoimmune disease caused by loss of death-receptor-induced apoptosis. Immunity 45, 513–526 (2016).
What is a LUNARIS mouse cytokine kit?
The LUNARIS Mouse Cytokine Kit (AYOXXA Biosystems) was used to determine cytokine levels in tissue homogenates according to the manufacturer’s instructions.
How are C362S mice generated?
Casp8C362S mice were generated by pronuclear injection of C57BL/6N zygotes with 20 ng µl −1 Cas9 mRNA (TriLink Biotechnologies), 10 ng µl −1 sgRNA and 20 ng µl −1 template DNA (Eurofins). Sequence of single-guide RNA (5′-CACCGTTTCATTCAGGCTTGCCA-3′) and template DNA (5′-CACTGGTTCAAAGTGCCCTTCCCTGTCTGGGAAACCCAAGATCTTTTTCATTCAGGCTAGCCAAGGAAGTAACTTCCAGAAAGGAGTGCCTGATGAGGCAGGCTTCGAGCAACAGAAC-3). Ear cuts were genotyped by Sanger sequencing (Microsynth SEQLAB) with PCR Primer (5′-TGCAAATGAAATCCACGAGA-3′ and 5′-CCAGGTTCCATTCACAGGAT-3′). Founders carrying the intended C362S mutation were backcrossed to a C57BL/6N genetic background for five generations. All mouse studies were performed after approval by local government authorities (LANUV, NRW, Germany) in accordance with the German animal protection law. Animals were housed in the animal care facility of the University of Cologne under standard pathogen-free conditions with a 12-h light/dark schedule and provided with food and water ad libitum. Calculations to determine sample size, randomization and blinding were not performed. Mice were grouped according to their phenotype in mixed sexes.
Does caspase 8 produce cytokines?
In addition to its role in apoptosis and necroptosis, recent in vitro studies have indicated that caspase-8 induces the production of cytokines by acting as a scaffolding protein and that this role is independent of its enzymatic activity 9, 10. The scaffold function of caspase-8 was also shown to be involved in the double-stranded RNA (dsRNA)-induced activation of the NLRP3 inflammasome in macrophages 11. Additional studies indicate that the enzymatic activity of caspase-8 is required for the activation of NF-κB and secretion of cytokines in response to activated antigen receptors, Fc receptors or Toll-like receptors (TLRs), independently of cell death 12, 13. To investigate the physiological role of the enzymatic activity of caspase-8, we generated knock-in mice that expressed catalytically inactive caspase-8 by mutating Cys362 in the substrate binding pocket to serine (C362S) (Extended Data Fig. 1a ). Although heterozygous Casp8C362S/WT mice were viable (Extended Data Fig. 1b ), Casp8C362S/C362S embryos died around embryonic day 11.5 (E11.5). Hyperaemia in the abdominal areas was detected in Casp8C362S/C362S embryos (Fig. 1a ), presumably owing to defects in vascular development, which resembles the phenotype of Casp8−/− embryos 7. In order to address the role of caspase-8 in vascular development, we used Tie2cre (also known as Tekcre) mice, in which efficient Cre-mediated recombination is induced in all endothelial cells and most haematopoietic cells 14. Loss of the catalytic activity of caspase-8 in Casp8C362S/flTie2cre mice or specific knockout of caspase-8 in the endothelial cells of Casp8fl/flTie2cre mice caused embryonic lethality at the same developmental stage as Casp8C362S/C362S embryos (Extended Data Fig. 1c, d ). Casp8C362S/flTie2cre and Casp8fl/flTie2cre embryos showed the same gross pathology associated with a decrease in yolk-sac vascularization (Fig. 1b and Extended Data Fig. 1d ).
Which enzyme is required to inhibit necroptosis?
Fig. 1: The enzymatic activity of caspase-8 is required to inhibit necroptosis.
